ets 1 shrna  (Santa Cruz Biotechnology)

Journal: International Journal of Molecular Sciences

Article Title: Autoantibodies Targeting AT 1 - and ET A -Receptors Link Endothelial Proliferation and Coagulation via Ets-1 Transcription Factor

doi: 10.3390/ijms23010244

Figure Lengend Snippet: SRC-IgG activate Ets-1. Non-stimulated cells (Ctrl) were used as references when natural ligands were included, whereas Ctrl-IgG served as references when only IgG were used. ( a ) HMEC-1 were stimulated with AT-II, ET-1, Ctrl-IgG or SRC-IgG, with or without pre-incubation with MEK-1 inhibitor. ERK1/2 activation was measured as the pERK/α-Tubulin ratios. ( b ) Ets-1 transcriptional ( left ) and translational levels ( right ) were measured over time after stimulation with Ctrl- or SRC-IgG. ( c ) Specificity was asserted by pre-treatment with an AT 1 R or ET A R inhibitor (Valsartan or Sitaxentan, respectively), before stimulation with Ctrl- or SRC-IgG. ( d ) ( left and right ) HMEC-1 were incubated with Ctrl-IgG, natural ligands or SRC-IgG with or without pre-incubation with respective receptor blockers. ( a – d ) n = 4; representative blots are shown. * p < 0.05.

Article Snippet: Membranes were probed with phospho-ERK (Cell Signaling, Danvers, MA, USA), α-Tubulin (Sigma Aldrich, Saint Louis, MI, USA), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Dallas, TX, USA or Hytest Ltd., Turku, Finland), p38-Ets-1 (Invitrogen, Carlsbad, CA, USA), Ets-1 (Santa Cruz, Dallas, TX, USA), TF (American Diagnostica, Pfungstadt, Germany) antibodies. shRNA vectors provided by Santa Cruz were used to deliver scrambled or Ets-1 shRNA.

Techniques: Incubation, Activation Assay

Journal: International Journal of Molecular Sciences

Article Title: Autoantibodies Targeting AT 1 - and ET A -Receptors Link Endothelial Proliferation and Coagulation via Ets-1 Transcription Factor

doi: 10.3390/ijms23010244

Figure Lengend Snippet: Endothelial cell proliferation elicited by SRC-IgG via ERK1/2–Ets-1 signaling. Non-stimulated cells (Ctrl) were used as reference when natural ligands were included, whereas Ctrl-IgG served as reference when only IgG were used. HMEC-1 were stimulated for 24 h with either natural ligands, Ctrl- or SRC-IgG, and specificity was assessed via two-hour pre-incubation with corresponding receptor inhibitors ( a ) ( left and right ) or cRaf1 inhibitor ( b ). ( c ) Abolition of Ets-1 translational regulation by shRNA following six-hour HMEC-1 stimulation. Ctrl shRNA corresponds to a mix of three control shRNA plasmids. Blots were over-exposed to better appreciate the decrease in the protein level. ( d ) Decrease in SRC-IgG induced endothelial cell proliferation by Ets-1 knockdown. ( a – c ) n = 4, ( d ) 7 ≤ n ≤ 11; representative blots are shown. * p < 0.05.

Article Snippet: Membranes were probed with phospho-ERK (Cell Signaling, Danvers, MA, USA), α-Tubulin (Sigma Aldrich, Saint Louis, MI, USA), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Dallas, TX, USA or Hytest Ltd., Turku, Finland), p38-Ets-1 (Invitrogen, Carlsbad, CA, USA), Ets-1 (Santa Cruz, Dallas, TX, USA), TF (American Diagnostica, Pfungstadt, Germany) antibodies. shRNA vectors provided by Santa Cruz were used to deliver scrambled or Ets-1 shRNA.

Techniques: Incubation, shRNA

Journal: International Journal of Molecular Sciences

Article Title: Autoantibodies Targeting AT 1 - and ET A -Receptors Link Endothelial Proliferation and Coagulation via Ets-1 Transcription Factor

doi: 10.3390/ijms23010244

Figure Lengend Snippet: Ets-1 binding to the TF promoter upon AT 1 R/ET A R stimulation by either respective natural peptide ligand or in response to SRC-IgG. ( a ) ( left and right ) Dual luciferase assay shows a TF promoter activity increase in response to either receptor-activating scenarios as compared with non-stimulated or Ctrl-IgG treated cells. ( b ) ( left and right ) Observed activation is abolished by specific AT 1 R or ET A R inhibitors. ( c ) EMSA performed with nucleus proteins of endothelial cells incubated with TF promoter DNA. Shift specificity was assessed using non-labeled DNA, the incubation with Ets-1-specific antibodies triggering a supershift. ( d ) ( left and right ) Chromatin immunoprecipitation (ChIP) performed using stimulated cells, the DNA of which was precipitated with an antibody directed against Ets-1. ( a ) left, ( b , d ) n = 4, ( a ) right, ( c ) n = 3; representative blots are shown. * p < 0.05.

Article Snippet: Membranes were probed with phospho-ERK (Cell Signaling, Danvers, MA, USA), α-Tubulin (Sigma Aldrich, Saint Louis, MI, USA), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Dallas, TX, USA or Hytest Ltd., Turku, Finland), p38-Ets-1 (Invitrogen, Carlsbad, CA, USA), Ets-1 (Santa Cruz, Dallas, TX, USA), TF (American Diagnostica, Pfungstadt, Germany) antibodies. shRNA vectors provided by Santa Cruz were used to deliver scrambled or Ets-1 shRNA.

Techniques: Binding Assay, Luciferase, Activity Assay, Activation Assay, Incubation, Labeling, Chromatin Immunoprecipitation

Journal: International Journal of Molecular Sciences

Article Title: Autoantibodies Targeting AT 1 - and ET A -Receptors Link Endothelial Proliferation and Coagulation via Ets-1 Transcription Factor

doi: 10.3390/ijms23010244

Figure Lengend Snippet: TF involvement in endothelial cell proliferation. Non-stimulated cells (Ctrl) were used as a reference when natural ligands were included, whereas Ctrl-IgG served as a reference when only IgG were used. ( a ) Transcriptional ( left ) and translational analysis ( right ) of TF after endothelial cell stimulation. ( b ) Specific inhibition of AT 1 R/ET A R abolishes TF activity increase. ( c ) Ets-1 knockdown abolishes TF protein synthesis. ( d ) BrdU incorporation shows that pre-incubation with a TF-blocking antibody annihilates endothelial cell proliferation elicited by SRC-IgG. ( a , c ) n = 4, ( d ), 4 ≤ n ≤ 7; representative blots are shown. * p < 0.05, ** p < 0.01.

Article Snippet: Membranes were probed with phospho-ERK (Cell Signaling, Danvers, MA, USA), α-Tubulin (Sigma Aldrich, Saint Louis, MI, USA), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Dallas, TX, USA or Hytest Ltd., Turku, Finland), p38-Ets-1 (Invitrogen, Carlsbad, CA, USA), Ets-1 (Santa Cruz, Dallas, TX, USA), TF (American Diagnostica, Pfungstadt, Germany) antibodies. shRNA vectors provided by Santa Cruz were used to deliver scrambled or Ets-1 shRNA.

Techniques: Cell Stimulation, Inhibition, Activity Assay, BrdU Incorporation Assay, Incubation, Blocking Assay

Journal: International Journal of Molecular Sciences

Article Title: Autoantibodies Targeting AT 1 - and ET A -Receptors Link Endothelial Proliferation and Coagulation via Ets-1 Transcription Factor

doi: 10.3390/ijms23010244

Figure Lengend Snippet: Proposed intracellular cascade following AT 1 R and ET A R activation by SRC-IgG. Binding of SRC-IgG to the receptors triggers the activation of cRaf1, MEK, ERK1/2 and, in turn, of Ets-1, through phosphorylation of its Thr38. Once activated, Ets-1 binds to the promoter of TF, triggering its expression (mRNA and protein). This intracellular pathway results in endothelial cell proliferation, inducing obliterative vasculopathy in SSc patients.

Article Snippet: Membranes were probed with phospho-ERK (Cell Signaling, Danvers, MA, USA), α-Tubulin (Sigma Aldrich, Saint Louis, MI, USA), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Santa Cruz, Dallas, TX, USA or Hytest Ltd., Turku, Finland), p38-Ets-1 (Invitrogen, Carlsbad, CA, USA), Ets-1 (Santa Cruz, Dallas, TX, USA), TF (American Diagnostica, Pfungstadt, Germany) antibodies. shRNA vectors provided by Santa Cruz were used to deliver scrambled or Ets-1 shRNA.

Techniques: Activation Assay, Binding Assay, Expressing

Journal: BMB Reports

Article Title: Endothelial-specific deletion of Ets-1 attenuates Angiotensin II-induced cardiac fibrosis via suppression of endothelial-to-mesenchymal transition

doi: 10.5483/BMBRep.2019.52.10.206

Figure Lengend Snippet: Endothelial deletion of Ets-1 attenuateds Ang II-induced cardiac hypertrophy. (A, B) Representative western blots and quantitative western blots analysis that showed ETS-1 expression in whole heart ventricle and isolated heart endothelial cells of Tie2-Cre + ; Ets-1 f/f mice compared with those of wild-type littermate control; (C) Systolic blood pressure measurement prior to and at 1 and 2 weeks after AngII infusion; (D) Statistical results of the heart weight/body weight (HW/BW) ratios (n = 6) at 2 weeks after AngII infusion; (E–H) H&E staining of the heart ventricular cross-sections (I–L); and cross sectional area (CSA) (M–P) at 2 weeks after AngII infusion. (Q) Statistical results of the left ventricular wall thickness at 2 weeks after AngII infusion and (R) cardiomyocyte CSA (n = 100 cells per section); (S–V) Echocardiography results at 2 weeks after AngII infusion (n = 6) (S: Interventricular septal thickness at diastole (IVSd), T: left ventricular internal diastolic diameter (LVIDd); U: left ventricular posterior wall thickness at diastole (LVPWd), V: Percent LV ejection fraction (EF)); (W) The mRNA expressions of ventricular ANP, BNP and β-MHC after 2 weeks of Ang II-infusion were detected by qRT-PCR (n = 6). Scale bar: (E–L) 1 mm; (M–P) 25 μm. *P < 0.05; # P < 0.05.

Article Snippet: Ets-1 shRNA plasmid (Ets-1 shRNA Sequence: CCGGCCT TGCAGACAGACTACTTCTCAAGAGAAAGTAGTCTGTCTGC AAGGTTTTTTG) and the lentiviral packaging vectors pCMV.DR8 and pMD2.G (Plasmid #12259, Addgene) were transfected in human embryonic kidney (HEK) 293T cells (ATCC, CRL-1573).

Techniques: Western Blot, Expressing, Isolation, Staining, Quantitative RT-PCR

Journal: BMB Reports

Article Title: Endothelial-specific deletion of Ets-1 attenuates Angiotensin II-induced cardiac fibrosis via suppression of endothelial-to-mesenchymal transition

doi: 10.5483/BMBRep.2019.52.10.206

Figure Lengend Snippet: Endothelial deletion of Ets-1 attenuateds AngII-induced cardiac fibrosis. Left ventricular sections were stained by Masson’s Trichrome (A–D) and Sirius Red (E–H) in the indicated groups following AngII infusion for 2 weeks, with quantification of collagen assessed by Masson’s Trichrome Stain (I) and, Sirius Red (J); (K) Quantitative PCR analysis of mRNA levels of collagen I, collagen III, TGF-β1 and CTGF in the hearts of the indicated groups following AngII infusion for 2 weeks (n = 6). Scale bar: (A–H) 25 μm. *P < 0.05; # P < 0.05.

Article Snippet: Ets-1 shRNA plasmid (Ets-1 shRNA Sequence: CCGGCCT TGCAGACAGACTACTTCTCAAGAGAAAGTAGTCTGTCTGC AAGGTTTTTTG) and the lentiviral packaging vectors pCMV.DR8 and pMD2.G (Plasmid #12259, Addgene) were transfected in human embryonic kidney (HEK) 293T cells (ATCC, CRL-1573).

Techniques: Staining, Real-time Polymerase Chain Reaction

Journal: BMB Reports

Article Title: Endothelial-specific deletion of Ets-1 attenuates Angiotensin II-induced cardiac fibrosis via suppression of endothelial-to-mesenchymal transition

doi: 10.5483/BMBRep.2019.52.10.206

Figure Lengend Snippet: Endothelial deletion of Ets-1 ameliorated AngII-induced EndMT. (A, B): Representative western blot and quantitative analysis that showed the mean CD31, α-SMA and FSP-1 levels in the cardiac homogenates from the Tie2-Cre; Ets-1 f/f and WT control mice 2 weeks after AngII infusion (n = 6); (C–N): Myocardial sections were co-immunostained to detect CD31 (green)/α-SMA (red) and imaged via fluorescence microscopy. (O): qRT-PCR analysis of the mRNA expression levels of Snail, Slug, Twist2 and ZEB1 in the myocardium 2 weeks after AngII infusion (n = 6). Scale bar: (C–N) 25 μm. *P < 0.05; # P < 0.05.

Article Snippet: Ets-1 shRNA plasmid (Ets-1 shRNA Sequence: CCGGCCT TGCAGACAGACTACTTCTCAAGAGAAAGTAGTCTGTCTGC AAGGTTTTTTG) and the lentiviral packaging vectors pCMV.DR8 and pMD2.G (Plasmid #12259, Addgene) were transfected in human embryonic kidney (HEK) 293T cells (ATCC, CRL-1573).

Techniques: Western Blot, Fluorescence, Microscopy, Quantitative RT-PCR, Expressing

Journal: BMB Reports

Article Title: Endothelial-specific deletion of Ets-1 attenuates Angiotensin II-induced cardiac fibrosis via suppression of endothelial-to-mesenchymal transition

doi: 10.5483/BMBRep.2019.52.10.206

Figure Lengend Snippet: Knockdown of Ets-1 alleviated TGF-β1 induced EndMT in H5V cells. (A, B) sh Ets-1 H5V cells were immunostained to detect ETS-1 (Red) and imaged via fluorescence microscopy. (C) Representative western blots and quantitative analysis that showed ETS-1 protein levels in sh Ets-1 H5V cells; (D–K) H5V cells were co-immunostained to detect CD31 (Red) and FSP-1 (Green), and imaged via fluorescence microscopy; (L) qRT-PCR analysis of the mRNA expression levels of FSP-1, α-SMA, CD31, E-Cadherin and N-Cadherin in H5V cells at 2 days after TGF-β1 treatment (n = 6); (M) qRT-PCR analysis of the mRNA expression levels of Snail, Slug, Twist1 and ZEB1 in H5V cells at 2 days after TGF-β1 treatment (n = 6). Scale bar: (A, B), (D–K) 25 μm. *P < 0.01; # P < 0.01.

Article Snippet: Ets-1 shRNA plasmid (Ets-1 shRNA Sequence: CCGGCCT TGCAGACAGACTACTTCTCAAGAGAAAGTAGTCTGTCTGC AAGGTTTTTTG) and the lentiviral packaging vectors pCMV.DR8 and pMD2.G (Plasmid #12259, Addgene) were transfected in human embryonic kidney (HEK) 293T cells (ATCC, CRL-1573).

Techniques: Fluorescence, Microscopy, Western Blot, Quantitative RT-PCR, Expressing